MyTaq Blut-PCR-Mix, 2x

EINLEITUNG

Tumornekrosefaktor alpha (TNF-α) war ein Zytokinprotein, das im Körper von vielen verschiedenen Zelltypen produziert wird1. Dieses Protein spielt eine Rolle bei den Immunfunktionen des Körpers wie Antitumor, antimikrobielle Aktivität und vermittelt Entzündungen2. Einige Untersuchungen haben gezeigt, dass es genetische Variationen in Form von Einzelnukleotid-Polymorphismen (SNPs) in der Promotorregion3 gibt, die die Produktion und Transkription von TNF-α reguliert und seine Reaktion auf Krankheiten beeinflusst4. Die SNPs in der TNF-α-Promotorsequenz wurden bei –308 (G/A), –238 (A/G), –857 (C/T), –1031 (T/C) und –1376 (T/C) gefunden )5.Einige Studien im Zusammenhang mit dem Polymorphismus des TNF-α-Genpromotors -308 wurden durchgeführt, um seine Beziehung zu verschiedenen Krankheiten zu sehen6,7. Polymorphismen an dieser Position beeinflussten die Anzahl der TNF-α-Expression stark. Einige mit Polymorphismus -308 assoziierte Krankheiten waren Schlaganfall5, Leberzellkarzinom8, Niere9 und Diabetes10.

Eine der Methoden, die die Analyse der SNPs erleichtern, ist die Polymerase-Kettenreaktion (PCR)11. Diese Methode erfordert kurze DNA-Sequenzen, die als Primer bezeichnet werden und dazu dienen, die Polymerisationsphase zu starten12. Damit die Amplifikation richtig funktioniert und gute Ergebnisse liefert, gehörten die Primersequenzen zu den wichtigen Faktoren, die berücksichtigt werden mussten13. Bei der Analyse des Polymorphismus in -308 variierten die verwendeten Primer stark8,10. Die Primersequenzen wurden im Allgemeinen durch Software erstellt und direkt im Amplifikationsprozess getestet13. Wenn die entworfenen Primer jedoch ungenau und nicht richtig optimiert waren, können durch PCR erzeugte DNA-Sequenzen nicht genau (weniger effizient) verglichen werden. Es kann auch zu einem Fehlpriming führen und mehrere unerwünschte PCR-Produkte produzieren. Es bestand ein Mangel an Informationen bezüglich universeller Primer zur Amplifikation von DNA-Sequenzen in der -308-Region. Daher war das Ziel dieser Forschung, universelle Primer für die TNF-α-Promotorregion zu entwerfen und zu optimieren, die als universelle Primer für den Nachweis von SNP in -308.s verwendet werden können

MATERIALEN UND METHODEN

Primerdesign: Das Design von universellen Primern in der TNF-α-308-Promotorregion wurde in silico durchgeführt. Diese Stufe begann mit dem Herunterladen von TNF-α-Gen-DNA-Sequenzen von der GenBank.

  • Dann wurden die universellen Primerkandidaten unter Verwendung der BLAST- und Primer3-Software entworfen. Das Zündhütchendesign wurde gemäß dem von der Software bereitgestellten Verfahren durchgeführt. Allgemeine Eigenschaften wie Schmelztemperatur, Prozentsatz von Guanin und Cytosin (GC) und Nukleotidlänge von Kandidaten für universelle Primer wurden angepasst.
  • Die Schmelztemperatur wurde auf einen Bereich von 52–58°C eingestellt, der Prozentsatz von Guanin und Cytosin auf einen Bereich von 40–60 % und die Länge der Nukleotide auf einen Bereich von 15–30 Nukleotiden13. Für den Zweck dieser Studie wurden fünf Primerpaare erzeugt.
  • Primersequenzen wurden von einem Anbieter von Herstellungsdiensten für synthetische Primer synthetisiert.

DNA-Probenvorbereitung: Als Proben wurde das periphere Blut von drei Menschen verwendet. Etwa 1 ml des Blutes wurde in Antikoagulansröhrchen gegeben, die Ethylendiamintetraessigsäure (EDTA) enthielten. Die DNAs aus den Blutproben wurden mit dem Genomic Mini Kit (Geneaid) extrahiert. Das Extraktionsverfahren wurde gemäß den Anweisungen durchgeführt. Die isolierte DNA wurde bis zur Verwendung im Kühlschrank aufbewahrt.

DNA-Amplifikation: Für jeden Primer wurden 3 DNA-Proben von drei verschiedenen Personen verwendet, was zu 15 Reaktionen führte. Das MyTaqTM HS Red Mix (Bioline) Polymerase Chain Reaction (PCR)-Kit wurde verwendet, um die Zielregionen zu amplifizieren. Das folgende Protokoll galt für eine 50-μl-Standardreaktion: 200 ng DNA, 1 μl Primer (jeweils 20 μM), 25 μl 2x MyTaq HS Red Mix und das Volumen wurde durch Zugabe von dH2O auf 50 μl eingestellt. Alle PCR-Reaktionsproben wurden mit einer Thermocycler-Maschine mit unterschiedlichen Temperatureinstellungen in jeder Stufe amplifiziert. Die anfängliche Denaturierungsstufe wurde bei 95°C für 2 min durchgeführt, gefolgt von 34 Denaturierungszyklen für 30 s bei 95°C, Annealing für 30 s bei einer durch Primerdesign eingestellten Temperatur und Elongation für 1 min bei 72°C, gefolgt durch abschließende Elongation für 1 min bei 72°C. Die Amplifikationsergebnisse wurden auf 1 % Agarosegel elektrophorisiert und photographiert.

RESULTATE UND DISKUSSION

Primerdesign: Die Primerpaare wurden unter Verwendung von BLAST- und Primer3-Software basierend auf TNF-α-Genpromotorsequenzen, die von GenBank abgerufen wurden, entworfen. Fünf universelle Primerpaare, die unter Verwendung dieser Software generiert wurden, sind in Tabelle 1 dargestellt. Diese Primerpaare wurden optimiert, um ihre Effizienz und Genauigkeit unter Verwendung des PCR-Verfahrens zur Amplifikation der TNF-α-Promotorregion zu bewerten.

Optimierung entworfener Primer: Die Ergebnisse der DNA-Optimierung wurden durch Elektrophorese unter Verwendung von 1 % Agarosegel sichtbar gemacht. Bei der Visualisierung der Amplifikationsergebnisse unter Verwendung von 5 Primern gibt es 2 Primerpaare (TNF-α 1 und TNF-α 2), die einzelne, klare und scharfe Banden zeigten, die einzelne, klare und scharfe Banden zeigten und keine Mehrfachbanden bildeten.
Die Länge der sichtbar gemachten Bande entspricht der Länge der Bande, die der Primer basierend auf den in silico entworfenen Primern erzeugt. Die Amplifikationsergebnisse unter Verwendung der Primerpaare TNF-&agr; 3, TNF-&agr; 4 und TNF-&agr; 5 erzeugten keine einzelnen Banden, sondern verteilte und mehrere Banden.

Primerdesign: Primer sind kurze Oligonukleotidmoleküle mit definierten Sequenzen, die komplementär zur Ziel-DNA sind, die den zu amplifizierenden Bereich begrenzen und als Verlängerungspunkt für die DNA-Polymerase dienen14. Die entworfenen Primer bestimmen den Erfolg der Amplifikation, daher ist das Primerdesign ein wichtiger Aspekt, um spezifische, wirksame und effiziente PCR-Produkte zu erhalten. Die Primer-Annealing-Temperatur muss für eine erfolgreiche Amplifikation spezifisch sein. Basierend auf den von Lorenz13 vorgeschlagenen Kriterien wurden unter Verwendung der BLAST – und Primer3 – Software fünf Kandidaten für universelle Primerpaare generiert .

Die Forward-Primer sollen in Vorwärtsrichtung amplifizieren, und die Reverse-Primer sollen in Rückwärtsrichtung amplifizieren15. Diese Primer hybridisieren an spezifische Stellen auf der Ziel-DNA-Sequenz zwischen den zu amplifizierenden Primer-Bindungsstellen16. Das Primer-Design reduziert die Komplexität und den zeitaufwändigen Aufwand, insbesondere wenn eine große Anzahl von Treffern generiert wird17.

Optimierung der entworfenen Primer: Die im Amplifikationsprozess verwendeten DNA-Proben wurden aus menschlichem peripherem Blut gewonnen. Blutproben enthalten noch Blutbestandteile, die den Amplifikationsprozess mittels PCR stören können.

  • Der DNA-Extraktionsprozess wurde durchgeführt, um reine DNA-Proben zu erhalten. Der Erfolg des Primerdesigns konnte am Erfolg der Initiation durch den Primer im Amplifikationsprozess gesehen werden. Wenn DNA in der von den Primern flankierten Region spezifisch amplifiziert wird, kann gesagt werden, dass Primerdesign und -optimierung erfolgreich sind.
  • Das Ergebnis  zeigte, dass die Primerpaare TNF-α 1 und TNF-α 2 in der Lage waren, die flankierte DNA-308-TNF-α-Promotorregion genau zu amplifizieren, jedoch die Primerpaare TNF-α 3, TNF-α 4 und TNF -α 5 zeigte mehrere Banden.
  • Dies kann durch mehrere Faktoren wie Temperatur, chemische Reaktion, Nukleotidzusammensetzung sowie Position und Art der Nukleotidfehlpaarung verursacht werden18.
  • Der Temperaturfaktor wird als wenig einflussreich auf die Ergebnisse der Amplifikation angesehen, da die Primer-Annealing-Temperatur gemäß der Theorie auf einen guten Temperaturbereich eingestellt wurde.
  • Ein weiterer Faktor, der Primer-Anheftungsfehler (Primer-Mispriming) verursachen kann, ist die Wiederholung von Dinukleotiden, die die Primer-Entropie erhöhen kann, so dass sie ein unspezifisches Primer-Annealing verursacht19.
  • Darüber hinaus kann auch darauf hingewiesen werden, dass das 3′-Ende des Primers einen Fehler machen kann, indem es sich an die falsche Stelle anheftet und dann durch DNA-Polymerase polymerisiert wird, um unerwünschte PCR-Produkte zu produzieren20.
  • Gut komplementierte Primer an Endposition 3′ können den Amplifikationsprozess gut einleiten21,22. Die Amplifikation unter Verwendung von TNF-α 3-, TNF-α 4- und TNF-α 5-Primerpaaren erfordert noch andere Optimierungsschritte wie Heißstart und Aufsetzen.
  • Dieser Prozess kann die Genauigkeit der Primer-Anheftung an den richtigen Bereich verbessern, um die gewünschten PCR-Produkte herzustellen. Dieser Prozess erfordert jedoch zusätzliche Zeit und es kann nicht sichergestellt werden, dass das richtige PCR-Produkt hergestellt wird.
  • Die Amplifikation mit den Primern TNF-α 1 und TNF-α 2 muss nicht weiter optimiert werden, da die ursprüngliche Visualisierung gezeigt hat, dass die Primerpaare die TNF-α-Promotorregion gut amplifizieren und die gewünschten Produkte gemäß den Designergebnissen produzieren konnten. Dieser Befund wird Forschern, die SNP-Forschung in der TNF-α-Promotorregion, insbesondere SNP in -308, durchführen, Bequemlichkeit bieten.

MyTaq Blood PCR Mix, 2x

BIO-25053/S Bioline Sample Ask for price

MyTaq Blood PCR Mix, 2x

BIO-25054 Bioline 250 Reactions Ask for price

MyTaq Mix, 2x

BIO-25041 Bioline 200 Reactions Ask for price

MyTaq Mix, 2x

BIO-25041/S Bioline Sample Ask for price

MyTaq Mix, 2x

BIO-25042 Bioline 1000 Reactions Ask for price

MyTaq HS Mix, 2x

BIO-25045 Bioline 200 Reactions Ask for price

MyTaq HS Mix, 2x

BIO-25045/S Bioline Sample Ask for price

MyTaq HS Mix, 2x

BIO-25046 Bioline 1000 Reactions Ask for price

MyTaq Red Mix, 2x

BIO-25043 Bioline 200 Reactions Ask for price

MyTaq Red Mix, 2x

BIO-25043/S Bioline Sample Ask for price

MyTaq Red Mix, 2x

BIO-25044 Bioline 1000 Reactions Ask for price

MyTaq HS Red Mix, 2x

BIO-25047 Bioline 200 Reactions Ask for price

MyTaq HS Red Mix, 2x

BIO-25047/S Bioline Sample Ask for price

MyTaq HS Red Mix, 2x

BIO-25048 Bioline 1000 Reactions Ask for price

Whole Blood PCR Mix

M1143-200 Biovision each 385.2 EUR

MyTaq Plant-PCR Kit

BIO-25055 Bioline 250 reactions Ask for price

MyTaq Plant-PCR Kit

BIO-25056 Bioline 500 reactions Ask for price

MyTaq Extract-PCR Kit

BIO-21126 Bioline 100 Reactions Ask for price

MyTaq Extract-PCR Kit

BIO-21126/S Bioline Sample Ask for price

MyTaq Extract-PCR Kit

BIO-21127 Bioline 500 Reactions Ask for price

MyTaq One-Step RT-PCR Kit

BIO-65048 Bioline 25 Reactions Ask for price

MyTaq One-Step RT-PCR Kit

BIO-65049 Bioline 100 Reactions Ask for price

FSP Taq Mix Direct for blood (2x)

84729 Sisco Laboratories 1 ml 63.2 EUR

FSP Taq Mix Direct for blood (2x)

84729-1 Sisco Laboratories 5 x1 ml 262.22 EUR

Taq Mix (2x) (PCR Master Mix (2x))

50900 Sisco Laboratories 1 ml 21.38 EUR

Taq Mix (2x) (PCR Master Mix (2x))

50900-1 Sisco Laboratories 5 x1 ml 64.14 EUR

Taq Mix (2x) (PCR Master Mix (2x))

50900-2 Sisco Laboratories 5 x2.5 ml 128.29 EUR

Ready PCR Mix 2X

11170052-1 Glycomatrix 1 Unit(s) 46.41 EUR

Ready PCR Mix 2X

11170052-2 Glycomatrix 2 Unit(s) 84.38 EUR

PowerPol 2X PCR Mix

RK20718 Abclonal 1mL 187.5 EUR

Roseate PCR Master Mix (2x) (Taq Mix (2x))

46503 Sisco Laboratories 1 ml 23.09 EUR

Roseate PCR Master Mix (2x) (Taq Mix (2x))

46503-1 Sisco Laboratories 5 x1 ml 70.13 EUR

Roseate PCR Master Mix (2x) (Taq Mix (2x))

46503-2 Sisco Laboratories 5 x2.5 ml 145.39 EUR

2x PCR Red Mix

TBS4004 Tribioscience 2.0 ml 88 EUR

2x PCR Blue Mix

TBS4005 Tribioscience 2.0 ml 88 EUR

PCR Master Mix 2X

11140011-1 Glycomatrix 100 Reaction(s) 171.48 EUR

PCR Master Mix 2X

11140011-2 Glycomatrix 200 Reaction(s) 323.39 EUR

PCR Master Mix 2X

11140011-3 Glycomatrix 500 Reaction(s) 692.46 EUR

Phusion Blood Direct PCR Master Mix - 500 x 20 µl rxns

THF-175L Westburg each 517.21 EUR

Phusion Blood Direct PCR Master Mix - 100 x 20 µl rxns

THF-175S Westburg each 119.36 EUR

MyTaq DNA Polymerase

BIO-21105 Bioline 500 units Ask for price

MyTaq DNA Polymerase

BIO-21105/S Bioline Sample Ask for price

MyTaq DNA Polymerase

BIO-21106 Bioline 2500 units Ask for price

MyTaq DNA Polymerase

BIO-21107 Bioline 5000 units Ask for price

Taq 2X PCR Mix V2

RK20607 Abclonal 5mL 4 EUR

2x Taq PCR Master Mix

A4145-1ML40Rxns Biomatik Corporation 1ML (40Rxns) 77 EUR

Taq PCR Master Mix (2x)

E2520-01 EURx 100reactions 38.15 EUR

Taq PCR Master Mix (2x)

E2520-02 EURx 200reactions 71.94 EUR

Taq PCR Master Mix (2x)

E2520-03 EURx 500reactions 155.87 EUR

Taq 2X PCR Master Mix

RK20602 Abclonal 500RXN 12.54 EUR

MyTaq HS DNA Polymerase

BIO-21111 Bioline 250 units Ask for price

MyTaq HS DNA Polymerase

BIO-21111/S Bioline Sample Ask for price

MyTaq HS DNA Polymerase

BIO-21112 Bioline 1000 units Ask for price

MyTaq HS DNA Polymerase

BIO-21113 Bioline 2500 units Ask for price

onTaq PCR Master Mix (2x)

E2714-01 EURx 100reactions 54.5 EUR

onTaq PCR Master Mix (2x)

E2714-02 EURx 200reactions 104.64 EUR

onTaq PCR Master Mix (2x)

E2714-03 EURx 500reactions 215.82 EUR

tiTaq PCR Master Mix (2x)

E2716-01 EURx 100reactions 47.96 EUR

tiTaq PCR Master Mix (2x)

E2716-02 EURx 200reactions 93.74 EUR

tiTaq PCR Master Mix (2x)

E2716-03 EURx 500reactions 191.84 EUR

MyTaq Red DNA Polymerase

BIO-21108 Bioline 500 units Ask for price

MyTaq Red DNA Polymerase

BIO-21108/S Bioline Sample Ask for price

MyTaq Red DNA Polymerase

BIO-21109 Bioline 2500 units Ask for price

MyTaq Red DNA Polymerase

BIO-21110 Bioline 5000 units Ask for price

Taq 2x PCR Mix 100 rxn

BA01501 Bioatlas 100rxn 112.8 EUR

Hybrid PCR Master Mix (2x)

E2750-01 EURx 100reactions 47.96 EUR

Hybrid PCR Master Mix (2x)

E2750-02 EURx 500reactions 191.84 EUR

OptiTaq PCR Master Mix (2x)

E2910-01 EURx 100reactions 42.51 EUR

OptiTaq PCR Master Mix (2x)

E2910-02 EURx 200reactions 78.48 EUR

OptiTaq PCR Master Mix (2x)

E2910-03 EURx 500reactions 155.87 EUR

HotTaq 2x PCR Mix 100 rxn

BA01503 Bioatlas 100rxn 144 EUR

RedTaq 2x PCR Mix 100 rxn

BA01507 Bioatlas 100rxn 175.2 EUR

onHybrid PCR Master Mix (2x)

E2755-01 EURx 100reactions 59.95 EUR

onHybrid PCR Master Mix (2x)

E2755-02 EURx 500reactions 239.8 EUR

tiOptiTaq PCR Master Mix (2x)

E2726-01 EURx 100reactions 54.5 EUR

tiOptiTaq PCR Master Mix (2x)

E2726-02 EURx 200reactions 104.64 EUR

tiOptiTaq PCR Master Mix (2x)

E2726-03 EURx 500reactions 215.82 EUR

Multiplex PCR Master Mix (2x)

E2820-01 EURx 50reactions 71.94 EUR

Multiplex PCR Master Mix (2x)

E2820-02 EURx 100reactions 131.89 EUR

Blood PCR Kit

20-abx09801320ulSystems Abbexa
  • Ask for price
  • Ask for price
  • 100 rxns × 20 ul Systems
  • 500 rxns × 20 ul Systems

Blood PCR Kit

abx098013-100l Abbexa 100 µl 337.5 EUR

Blood PCR Kit

abx098013-1ml Abbexa 1 ml Ask for price

Blood PCR Kit

abx098013-200l Abbexa 200 µl 762.5 EUR

Bloodirect 2X PCR MasterMix

G465 ABM 5.0 ml (200 Rxns) 166.8 EUR

MyTaq HS Red DNA Polymerase

BIO-21114/S Bioline Sample Ask for price

MyTaq HS Red DNA Polymerase

BIO-21115 Bioline 1000 units Ask for price

MyTaq HS Red DNA Polymerase

BIO-21116 Bioline 2500 units Ask for price

TruePol 2X PCR Mix for NGS

RK20726 Abclonal 24RXN 51.78 EUR

FAZIT: Basierend auf den Ergebnissen des Designs und der Optimierung der Primer, die an 5 Primerpaaren durchgeführt wurden, wird empfohlen, 2 Primerpaare als universelle Primer zu verwenden, um die TNF-α-308-Promotorregion zu amplifizieren: TNF-α 1 (TNF- &agr; 1F: AACCAGCATT ATGAGTCTC und TNF-&agr; 1R: AACAACTGCCTTTATATGTC) und Primer TNF-&agr; 2 (TNF-&agr; 2F: TGAAACCAGCATTATGAGT und TNF-&agr; 2R: GGGAAAGAATCATTCAACC).

Schreibe einen Kommentar