MyTaq Blut-PCR-Mix, 2x


Tumornekrosefaktor alpha (TNF-α) war ein Zytokinprotein, das im Körper von vielen verschiedenen Zelltypen produziert wird1. Dieses Protein spielt eine Rolle bei den Immunfunktionen des Körpers wie Antitumor, antimikrobielle Aktivität und vermittelt Entzündungen2. Einige Untersuchungen haben gezeigt, dass es genetische Variationen in Form von Einzelnukleotid-Polymorphismen (SNPs) in der Promotorregion3 gibt, die die Produktion und Transkription von TNF-α reguliert und seine Reaktion auf Krankheiten beeinflusst4. Die SNPs in der TNF-α-Promotorsequenz wurden bei –308 (G/A), –238 (A/G), –857 (C/T), –1031 (T/C) und –1376 (T/C) gefunden )5.Einige Studien im Zusammenhang mit dem Polymorphismus des TNF-α-Genpromotors -308 wurden durchgeführt, um seine Beziehung zu verschiedenen Krankheiten zu sehen6,7. Polymorphismen an dieser Position beeinflussten die Anzahl der TNF-α-Expression stark. Einige mit Polymorphismus -308 assoziierte Krankheiten waren Schlaganfall5, Leberzellkarzinom8, Niere9 und Diabetes10.

Eine der Methoden, die die Analyse der SNPs erleichtern, ist die Polymerase-Kettenreaktion (PCR)11. Diese Methode erfordert kurze DNA-Sequenzen, die als Primer bezeichnet werden und dazu dienen, die Polymerisationsphase zu starten12. Damit die Amplifikation richtig funktioniert und gute Ergebnisse liefert, gehörten die Primersequenzen zu den wichtigen Faktoren, die berücksichtigt werden mussten13. Bei der Analyse des Polymorphismus in -308 variierten die verwendeten Primer stark8,10. Die Primersequenzen wurden im Allgemeinen durch Software erstellt und direkt im Amplifikationsprozess getestet13. Wenn die entworfenen Primer jedoch ungenau und nicht richtig optimiert waren, können durch PCR erzeugte DNA-Sequenzen nicht genau (weniger effizient) verglichen werden. Es kann auch zu einem Fehlpriming führen und mehrere unerwünschte PCR-Produkte produzieren. Es bestand ein Mangel an Informationen bezüglich universeller Primer zur Amplifikation von DNA-Sequenzen in der -308-Region. Daher war das Ziel dieser Forschung, universelle Primer für die TNF-α-Promotorregion zu entwerfen und zu optimieren, die als universelle Primer für den Nachweis von SNP in -308.s verwendet werden können


Primerdesign: Das Design von universellen Primern in der TNF-α-308-Promotorregion wurde in silico durchgeführt. Diese Stufe begann mit dem Herunterladen von TNF-α-Gen-DNA-Sequenzen von der GenBank.

  • Dann wurden die universellen Primerkandidaten unter Verwendung der BLAST- und Primer3-Software entworfen. Das Zündhütchendesign wurde gemäß dem von der Software bereitgestellten Verfahren durchgeführt. Allgemeine Eigenschaften wie Schmelztemperatur, Prozentsatz von Guanin und Cytosin (GC) und Nukleotidlänge von Kandidaten für universelle Primer wurden angepasst.
  • Die Schmelztemperatur wurde auf einen Bereich von 52–58°C eingestellt, der Prozentsatz von Guanin und Cytosin auf einen Bereich von 40–60 % und die Länge der Nukleotide auf einen Bereich von 15–30 Nukleotiden13. Für den Zweck dieser Studie wurden fünf Primerpaare erzeugt.
  • Primersequenzen wurden von einem Anbieter von Herstellungsdiensten für synthetische Primer synthetisiert.

DNA-Probenvorbereitung: Als Proben wurde das periphere Blut von drei Menschen verwendet. Etwa 1 ml des Blutes wurde in Antikoagulansröhrchen gegeben, die Ethylendiamintetraessigsäure (EDTA) enthielten. Die DNAs aus den Blutproben wurden mit dem Genomic Mini Kit (Geneaid) extrahiert. Das Extraktionsverfahren wurde gemäß den Anweisungen durchgeführt. Die isolierte DNA wurde bis zur Verwendung im Kühlschrank aufbewahrt.

DNA-Amplifikation: Für jeden Primer wurden 3 DNA-Proben von drei verschiedenen Personen verwendet, was zu 15 Reaktionen führte. Das MyTaqTM HS Red Mix (Bioline) Polymerase Chain Reaction (PCR)-Kit wurde verwendet, um die Zielregionen zu amplifizieren. Das folgende Protokoll galt für eine 50-μl-Standardreaktion: 200 ng DNA, 1 μl Primer (jeweils 20 μM), 25 μl 2x MyTaq HS Red Mix und das Volumen wurde durch Zugabe von dH2O auf 50 μl eingestellt. Alle PCR-Reaktionsproben wurden mit einer Thermocycler-Maschine mit unterschiedlichen Temperatureinstellungen in jeder Stufe amplifiziert. Die anfängliche Denaturierungsstufe wurde bei 95°C für 2 min durchgeführt, gefolgt von 34 Denaturierungszyklen für 30 s bei 95°C, Annealing für 30 s bei einer durch Primerdesign eingestellten Temperatur und Elongation für 1 min bei 72°C, gefolgt durch abschließende Elongation für 1 min bei 72°C. Die Amplifikationsergebnisse wurden auf 1 % Agarosegel elektrophorisiert und photographiert.


Primerdesign: Die Primerpaare wurden unter Verwendung von BLAST- und Primer3-Software basierend auf TNF-α-Genpromotorsequenzen, die von GenBank abgerufen wurden, entworfen. Fünf universelle Primerpaare, die unter Verwendung dieser Software generiert wurden, sind in Tabelle 1 dargestellt. Diese Primerpaare wurden optimiert, um ihre Effizienz und Genauigkeit unter Verwendung des PCR-Verfahrens zur Amplifikation der TNF-α-Promotorregion zu bewerten.

Optimierung entworfener Primer: Die Ergebnisse der DNA-Optimierung wurden durch Elektrophorese unter Verwendung von 1 % Agarosegel sichtbar gemacht. Bei der Visualisierung der Amplifikationsergebnisse unter Verwendung von 5 Primern gibt es 2 Primerpaare (TNF-α 1 und TNF-α 2), die einzelne, klare und scharfe Banden zeigten, die einzelne, klare und scharfe Banden zeigten und keine Mehrfachbanden bildeten.
Die Länge der sichtbar gemachten Bande entspricht der Länge der Bande, die der Primer basierend auf den in silico entworfenen Primern erzeugt. Die Amplifikationsergebnisse unter Verwendung der Primerpaare TNF-&agr; 3, TNF-&agr; 4 und TNF-&agr; 5 erzeugten keine einzelnen Banden, sondern verteilte und mehrere Banden.

Primerdesign: Primer sind kurze Oligonukleotidmoleküle mit definierten Sequenzen, die komplementär zur Ziel-DNA sind, die den zu amplifizierenden Bereich begrenzen und als Verlängerungspunkt für die DNA-Polymerase dienen14. Die entworfenen Primer bestimmen den Erfolg der Amplifikation, daher ist das Primerdesign ein wichtiger Aspekt, um spezifische, wirksame und effiziente PCR-Produkte zu erhalten. Die Primer-Annealing-Temperatur muss für eine erfolgreiche Amplifikation spezifisch sein. Basierend auf den von Lorenz13 vorgeschlagenen Kriterien wurden unter Verwendung der BLAST – und Primer3 – Software fünf Kandidaten für universelle Primerpaare generiert .

Die Forward-Primer sollen in Vorwärtsrichtung amplifizieren, und die Reverse-Primer sollen in Rückwärtsrichtung amplifizieren15. Diese Primer hybridisieren an spezifische Stellen auf der Ziel-DNA-Sequenz zwischen den zu amplifizierenden Primer-Bindungsstellen16. Das Primer-Design reduziert die Komplexität und den zeitaufwändigen Aufwand, insbesondere wenn eine große Anzahl von Treffern generiert wird17.

Optimierung der entworfenen Primer: Die im Amplifikationsprozess verwendeten DNA-Proben wurden aus menschlichem peripherem Blut gewonnen. Blutproben enthalten noch Blutbestandteile, die den Amplifikationsprozess mittels PCR stören können.

  • Der DNA-Extraktionsprozess wurde durchgeführt, um reine DNA-Proben zu erhalten. Der Erfolg des Primerdesigns konnte am Erfolg der Initiation durch den Primer im Amplifikationsprozess gesehen werden. Wenn DNA in der von den Primern flankierten Region spezifisch amplifiziert wird, kann gesagt werden, dass Primerdesign und -optimierung erfolgreich sind.
  • Das Ergebnis  zeigte, dass die Primerpaare TNF-α 1 und TNF-α 2 in der Lage waren, die flankierte DNA-308-TNF-α-Promotorregion genau zu amplifizieren, jedoch die Primerpaare TNF-α 3, TNF-α 4 und TNF -α 5 zeigte mehrere Banden.
  • Dies kann durch mehrere Faktoren wie Temperatur, chemische Reaktion, Nukleotidzusammensetzung sowie Position und Art der Nukleotidfehlpaarung verursacht werden18.
  • Der Temperaturfaktor wird als wenig einflussreich auf die Ergebnisse der Amplifikation angesehen, da die Primer-Annealing-Temperatur gemäß der Theorie auf einen guten Temperaturbereich eingestellt wurde.
  • Ein weiterer Faktor, der Primer-Anheftungsfehler (Primer-Mispriming) verursachen kann, ist die Wiederholung von Dinukleotiden, die die Primer-Entropie erhöhen kann, so dass sie ein unspezifisches Primer-Annealing verursacht19.
  • Darüber hinaus kann auch darauf hingewiesen werden, dass das 3′-Ende des Primers einen Fehler machen kann, indem es sich an die falsche Stelle anheftet und dann durch DNA-Polymerase polymerisiert wird, um unerwünschte PCR-Produkte zu produzieren20.
  • Gut komplementierte Primer an Endposition 3′ können den Amplifikationsprozess gut einleiten21,22. Die Amplifikation unter Verwendung von TNF-α 3-, TNF-α 4- und TNF-α 5-Primerpaaren erfordert noch andere Optimierungsschritte wie Heißstart und Aufsetzen.
  • Dieser Prozess kann die Genauigkeit der Primer-Anheftung an den richtigen Bereich verbessern, um die gewünschten PCR-Produkte herzustellen. Dieser Prozess erfordert jedoch zusätzliche Zeit und es kann nicht sichergestellt werden, dass das richtige PCR-Produkt hergestellt wird.
  • Die Amplifikation mit den Primern TNF-α 1 und TNF-α 2 muss nicht weiter optimiert werden, da die ursprüngliche Visualisierung gezeigt hat, dass die Primerpaare die TNF-α-Promotorregion gut amplifizieren und die gewünschten Produkte gemäß den Designergebnissen produzieren konnten. Dieser Befund wird Forschern, die SNP-Forschung in der TNF-α-Promotorregion, insbesondere SNP in -308, durchführen, Bequemlichkeit bieten.

MyTaq Blood PCR Mix, 2x

BIO-25053/S Bioline Sample Ask for price

MyTaq Blood PCR Mix, 2x

BIO-25054 Bioline 250 Reactions Ask for price

MyTaq Mix, 2x

BIO-25041 Bioline 200 Reactions Ask for price

MyTaq Mix, 2x

BIO-25041/S Bioline Sample Ask for price

MyTaq Mix, 2x

BIO-25042 Bioline 1000 Reactions Ask for price

MyTaq Red Mix, 2x

BIO-25043 Bioline 200 Reactions Ask for price

MyTaq Red Mix, 2x

BIO-25043/S Bioline Sample Ask for price

MyTaq Red Mix, 2x

BIO-25044 Bioline 1000 Reactions Ask for price

MyTaq HS Mix, 2x

BIO-25045 Bioline 200 Reactions Ask for price

MyTaq HS Mix, 2x

BIO-25045/S Bioline Sample Ask for price

MyTaq HS Mix, 2x

BIO-25046 Bioline 1000 Reactions Ask for price

MyTaq HS Red Mix, 2x

BIO-25047 Bioline 200 Reactions Ask for price

MyTaq HS Red Mix, 2x

BIO-25047/S Bioline Sample Ask for price

MyTaq HS Red Mix, 2x

BIO-25048 Bioline 1000 Reactions Ask for price

Whole Blood PCR Mix

M1143-200 Biovision 321 EUR

Taq 2x PCR Mix 100 rxn

BA01501 Bioatlas 100rxn 94 EUR

HotTaq 2x PCR Mix 100 rxn

BA01503 Bioatlas 100rxn 120 EUR

RedTaq 2x PCR Mix 100 rxn

BA01507 Bioatlas 100rxn 146 EUR

amfiSure ONE PCR Master Mix(2X)

P7000-005 GenDepot 5x1 ml 219 EUR

amfiSure ONE PCR Master Mix(2X)

P7000-010 GenDepot 10x1 ml 317 EUR

amfiSure ONE PCR Master Mix(2X)

P7000-050 GenDepot 50x1 ml 1211 EUR

amfiSure ONE PCR Master Mix(2X)

P7000-100 GenDepot 100x1 ml 2102 EUR

HotStart PCR Master mix (2X, Green Dye)

BS9291 Bio Basic 5X1mL, 5ml 209.5 EUR

HotStart PCR Master mix (2X, Green Dye)

BS9292 Bio Basic 1ml 96.4 EUR

Taq PCR Master Mix (2X, Blue Dye)

BS9295 Bio Basic 1ml 84.8 EUR

Taq PCR Master Mix (2X, Blue Dye)

BS9296 Bio Basic 5ml 189.2 EUR

Taq PCR Master Mix (2X, Red Dye)

BS9297 Bio Basic 1ml 84.8 EUR

Taq PCR Master Mix (2X, Red Dye)

BS9298 Bio Basic 5ml 189.2 EUR

Smart 2X PCR pre-mix Pfu (30ul)

9K-002-0038 Bio Basic 30uL, 30uL 581.14 EUR

amfiFusion High Fidelity PCR Master Mix(2X)

P0342-010 GenDepot 2x50 rxns 253 EUR

amfiFusion High Fidelity PCR Master Mix(2X)

P0342-025 GenDepot 5X50 rxns 455 EUR

amfiFusion High Fidelity PCR Master Mix(2X)

P0342-050 GenDepot 10X50 rxns 779 EUR

amfiFusion High Fidelity PCR Master Mix(2X)

P0342-100 GenDepot 20x50 rxns 1333 EUR

amfiSure Ultra Fidelity PCR Master Mix(2X)

P0346-001 GenDepot 1ml 280 EUR

amfiSure Ultra Fidelity PCR Master Mix(2X)

P0346-002 GenDepot 2x1ml 482 EUR

amfiSure Ultra Fidelity PCR Master Mix(2X)

P0346-005 GenDepot 5x1ml 828 EUR

amfiSure Ultra Fidelity PCR Master Mix(2X)

P0346-010 GenDepot 10x1ml 1360 EUR


BIO-25028 Bioline 500 Reactions Ask for price

MyFi Mix, 2x

BIO-25049 Bioline 100 Reactions Ask for price

MyFi Mix, 2x

BIO-25049/S Bioline Sample Ask for price

MyFi Mix, 2x

BIO-25050 Bioline 500 Reactions Ask for price

Ranger Mix, 2x

BIO-25051/S Bioline Sample Ask for price

Ranger Mix, 2x

BIO-25052 Bioline 500 Reactions Ask for price

amfiSure qGreen Q-PCR Master Mix(2X), Fluorescein

Q5601-001 GenDepot 1ml 146 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Fluorescein

Q5601-002 GenDepot 2x1ml 207 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Fluorescein

Q5601-005 GenDepot 5x1ml 266 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Fluorescein

Q5601-010 GenDepot 10x1ml 442 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Fluorescein

Q5601-050 GenDepot 50x1ml 1670 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Fluorescein

Q5701-001 GenDepot 1ml 174 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Fluorescein

Q5701-002 GenDepot 2x1ml 266 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Fluorescein

Q5701-005 GenDepot 5x1ml 469 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Fluorescein

Q5701-010 GenDepot 10x1ml 739 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Fluorescein

Q5701-050 GenDepot 50x1ml 2885 EUR

amfiSure qGreen Q-PCR Master Mix(2X), No Rox

Q5600-001 GenDepot 1ml 146 EUR

amfiSure qGreen Q-PCR Master Mix(2X), No Rox

Q5600-002 GenDepot 2x1ml 207 EUR

amfiSure qGreen Q-PCR Master Mix(2X), No Rox

Q5600-005 GenDepot 5x1ml 269 EUR

amfiSure qGreen Q-PCR Master Mix(2X), No Rox

Q5600-010 GenDepot 10x1ml 448 EUR

amfiSure qGreen Q-PCR Master Mix(2X), No Rox

Q5600-050 GenDepot 50x1ml 1738 EUR

amfiSure qGreen Q-PCR Master Mix(2X), High Rox

Q5602-001 GenDepot 1ml 146 EUR

amfiSure qGreen Q-PCR Master Mix(2X), High Rox

Q5602-002 GenDepot 2x1ml 207 EUR

amfiSure qGreen Q-PCR Master Mix(2X), High Rox

Q5602-005 GenDepot 5x1ml 266 EUR

amfiSure qGreen Q-PCR Master Mix(2X), High Rox

Q5602-010 GenDepot 10x1ml 442 EUR

amfiSure qGreen Q-PCR Master Mix(2X), High Rox

Q5602-050 GenDepot 50x1ml 1670 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Low Rox

Q5603-001 GenDepot 1ml 146 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Low Rox

Q5603-002 GenDepot 2x1ml 207 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Low Rox

Q5603-005 GenDepot 5x1ml 266 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Low Rox

Q5603-010 GenDepot 10x1ml 442 EUR

amfiSure qGreen Q-PCR Master Mix(2X), Low Rox

Q5603-050 GenDepot 50x1ml 1670 EUR

amfiSure qProbe Q-PCR Master Mix(2X), No Rox

Q5700-001 GenDepot 1ml 174 EUR

amfiSure qProbe Q-PCR Master Mix(2X), No Rox

Q5700-002 GenDepot 2x1ml 266 EUR

amfiSure qProbe Q-PCR Master Mix(2X), No Rox

Q5700-005 GenDepot 5x1ml 469 EUR

amfiSure qProbe Q-PCR Master Mix(2X), No Rox

Q5700-010 GenDepot 10x1ml 739 EUR

amfiSure qProbe Q-PCR Master Mix(2X), No Rox

Q5700-050 GenDepot 50x1ml 2885 EUR

amfiSure qProbe Q-PCR Master Mix(2X), High Rox

Q5702-001 GenDepot 1ml 174 EUR

amfiSure qProbe Q-PCR Master Mix(2X), High Rox

Q5702-002 GenDepot 2x1ml 266 EUR

amfiSure qProbe Q-PCR Master Mix(2X), High Rox

Q5702-005 GenDepot 5x1ml 469 EUR

amfiSure qProbe Q-PCR Master Mix(2X), High Rox

Q5702-010 GenDepot 10x1ml 739 EUR

amfiSure qProbe Q-PCR Master Mix(2X), High Rox

Q5702-050 GenDepot 50x1ml 334 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Low Rox

Q5703-001 GenDepot 1ml 174 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Low Rox

Q5703-002 GenDepot 2x1ml 266 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Low Rox

Q5703-003 GenDepot 5x1ml 469 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Low Rox

Q5703-004 GenDepot 10x1ml 739 EUR

amfiSure qProbe Q-PCR Master Mix(2X), Low Rox

Q5703-005 GenDepot 50x1ml 2885 EUR

MyTaq Extract-PCR Kit

BIO-21126 Bioline 100 Reactions Ask for price

MyTaq Extract-PCR Kit

BIO-21126/S Bioline Sample Ask for price

MyTaq Extract-PCR Kit

BIO-21127 Bioline 500 Reactions Ask for price

MyTaq Plant-PCR Kit

BIO-25055 Bioline 250 reactions Ask for price

MyTaq Plant-PCR Kit

BIO-25056 Bioline 500 reactions Ask for price

FAZIT: Basierend auf den Ergebnissen des Designs und der Optimierung der Primer, die an 5 Primerpaaren durchgeführt wurden, wird empfohlen, 2 Primerpaare als universelle Primer zu verwenden, um die TNF-α-308-Promotorregion zu amplifizieren: TNF-α 1 (TNF- &agr; 1F: AACCAGCATT ATGAGTCTC und TNF-&agr; 1R: AACAACTGCCTTTATATGTC) und Primer TNF-&agr; 2 (TNF-&agr; 2F: TGAAACCAGCATTATGAGT und TNF-&agr; 2R: GGGAAAGAATCATTCAACC).

Leave a Comment